-
1دورية أكاديمية
المؤلفون: Yingwei Hu, Jianbo Pan, Punit Shah, Minghui Ao, Stefani N. Thomas, Yang Liu, Lijun Chen, Michael Schnaubelt, David J. Clark, Henry Rodriguez, Emily S. Boja, Tara Hiltke, Christopher R. Kinsinger, Karin D. Rodland, Qing Kay Li, Jiang Qian, Zhen Zhang, Daniel W. Chan, Hui Zhang, Akhilesh Pandey, Amanda Paulovich, Andrew Hoofnagle, Bing Zhang, D.R. Mani, Daniel C. Liebler, David F. Ransohoff, David Fenyo, David L. Tabb, Douglas A. Levine, Eric Kuhn, Forest M. White, Gordon A. Whiteley, Heng Zhu, Ie-Ming Shih, Jasmin Bavarva, Jason E. McDermott, Jeffrey Whiteaker, Karen A. Ketchum, Karl R. Clauser, Kelly Ruggles, Kimberly Elburn, Li Ding, Linda Hannick, Lisa J. Zimmerman, Mark Watson, Mathangi Thiagarajan, Matthew J.C. Ellis, Mauricio Oberti, Mehdi Mesri, Melinda E. Sanders, Melissa Borucki, Michael A. Gillette, Michael Snyder, Nathan J. Edwards, Negin Vatanian, Paul A. Rudnick, Peter B. McGarvey, Philip Mertins, R. Reid Townsend, Ratna R. Thangudu, Richard D. Smith, Robert C. Rivers, Robert J.C. Slebos, Samuel H. Payne, Sherri R. Davies, Shuang Cai, Stephen E. Stein, Steven A. Carr, Steven J. Skates, Subha Madhavan, Tao Liu, Xian Chen, Yingming Zhao, Yue Wang, Zhiao Shi
المصدر: Cell Reports, Vol 33, Iss 3, Pp 108276- (2020)
مصطلحات موضوعية: CPTAC, glycosylation, mass spectrometry, glycoproteomics, tumor clusters, high-grade serous ovarian carcinoma, Biology (General), QH301-705.5
الوصف: Summary: Many gene products exhibit great structural heterogeneity because of an array of modifications. These modifications are not directly encoded in the genomic template but often affect the functionality of proteins. Protein glycosylation plays a vital role in proper protein functions. However, the analysis of glycoproteins has been challenging compared with other protein modifications, such as phosphorylation. Here, we perform an integrated proteomic and glycoproteomic analysis of 83 prospectively collected high-grade serous ovarian carcinoma (HGSC) and 23 non-tumor tissues. Integration of the expression data from global proteomics and glycoproteomics reveals tumor-specific glycosylation, uncovers different glycosylation associated with three tumor clusters, and identifies glycosylation enzymes that were correlated with the altered glycosylation. In addition to providing a valuable resource, these results provide insights into the potential roles of glycosylation in the pathogenesis of HGSC, with the possibility of distinguishing pathological outcomes of ovarian tumors from non-tumors, as well as classifying tumor clusters.
وصف الملف: electronic resource
-
2دورية أكاديمية
المؤلفون: Kelly A Brayton, Audrey O T Lau, David R Herndon, Linda Hannick, Lowell S Kappmeyer, Shawn J Berens, Shelby L Bidwell, Wendy C Brown, Jonathan Crabtree, Doug Fadrosh, Tamara Feldblum, Heather A Forberger, Brian J Haas, Jeanne M Howell, Hoda Khouri, Hean Koo, David J Mann, Junzo Norimine, Ian T Paulsen, Diana Radune, Qinghu Ren, Roger K Smith, Carlos E Suarez, Owen White, Jennifer R Wortman, Donald P Knowles, Terry F McElwain, Vishvanath M Nene
المصدر: PLoS Pathogens, Vol 3, Iss 10, Pp 1401-1413 (2007)
مصطلحات موضوعية: Immunologic diseases. Allergy, RC581-607, Biology (General), QH301-705.5
الوصف: Babesia bovis is an apicomplexan tick-transmitted pathogen of cattle imposing a global risk and severe constraints to livestock health and economic development. The complete genome sequence was undertaken to facilitate vaccine antigen discovery, and to allow for comparative analysis with the related apicomplexan hemoprotozoa Theileria parva and Plasmodium falciparum. At 8.2 Mbp, the B. bovis genome is similar in size to that of Theileria spp. Structural features of the B. bovis and T. parva genomes are remarkably similar, and extensive synteny is present despite several chromosomal rearrangements. In contrast, B. bovis and P. falciparum, which have similar clinical and pathological features, have major differences in genome size, chromosome number, and gene complement. Chromosomal synteny with P. falciparum is limited to microregions. The B. bovis genome sequence has allowed wide scale analyses of the polymorphic variant erythrocyte surface antigen protein (ves1 gene) family that, similar to the P. falciparum var genes, is postulated to play a role in cytoadhesion, sequestration, and immune evasion. The approximately 150 ves1 genes are found in clusters that are distributed throughout each chromosome, with an increased concentration adjacent to a physical gap on chromosome 1 that contains multiple ves1-like sequences. ves1 clusters are frequently linked to a novel family of variant genes termed smorfs that may themselves contribute to immune evasion, may play a role in variant erythrocyte surface antigen protein biology, or both. Initial expression analysis of ves1 and smorf genes indicates coincident transcription of multiple variants. B. bovis displays a limited metabolic potential, with numerous missing pathways, including two pathways previously described for the P. falciparum apicoplast. This reduced metabolic potential is reflected in the B. bovis apicoplast, which appears to have fewer nuclear genes targeted to it than other apicoplast containing organisms. Finally, comparative analyses have identified several novel vaccine candidates including a positional homolog of p67 and SPAG-1, Theileria sporozoite antigens targeted for vaccine development. The genome sequence provides a greater understanding of B. bovis metabolism and potential avenues for drug therapies and vaccine development.
وصف الملف: electronic resource
-
3دورية أكاديمية
المؤلفون: Rita C Kuo, Huan Zhang, Yunyun Zhuang, Linda Hannick, Senjie Lin
المصدر: PLoS ONE, Vol 8, Iss 4, p e60826 (2013)
الوصف: Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
وصف الملف: electronic resource
-
4
المؤلفون: Huan Zhang, James D. Stuart, Rita C. Kuo, Senjie Lin, Linda Hannick, Anthony A. Provatas
المصدر: Journal of Phycology. 57:577-591
مصطلحات موضوعية: 0106 biological sciences, chemistry.chemical_classification, Fatty Acid Synthases, 010604 marine biology & hydrobiology, Fatty Acids, Euglenozoa, Fatty acid, Lipid metabolism, Plant Science, Aquatic Science, Biology, 010603 evolutionary biology, 01 natural sciences, Acyl carrier protein, Fatty acid desaturase, Biochemistry, chemistry, Tandem Mass Spectrometry, Docosahexaenoic acid, Lipid biosynthesis, Fatty Acids, Unsaturated, biology.protein, lipids (amino acids, peptides, and proteins), Transcriptome, Polyunsaturated fatty acid
الوصف: Algal lipids are important molecules to store energy in algae and transfer energy in the marine food chain, and are potential materials for high value nutraceuticals (e.g., omega-3 fatty acids) or biofuel production. However, how lipid biosynthesis is regulated is not well understood in many species including Eutreptiella from the phylum of Euglenozoa. Here, we characterized the fatty acid (FA) profile of an Eutreptiella species isolated from Long Island Sound, USA, using gas chromatography-tandem mass spectrometry (GC/MS/MS) and investigated their biosynthesis pathways by transcriptome sequencing. We discovered 24 types of FAs including a relatively high proportion of long-chain unsaturated FAs. The abundances of C16, C18, and saturated FAs decreased when phosphate in the culture medium was depleted. Among the 24 FAs, docosahexaenoic acid (C22:6∆4,7,10,13,16,19 ) was most abundant, suggesting that Eutreptiella sp. preferentially invests in the synthesis of long-chain polyunsaturated fatty acids (LC-PFAs). Further transcriptomic analysis revealed that Eutreptiella sp. likely synthesizes LC-PFAs via ∆8 pathway and uses type I and II fatty acid synthases. Using RT-qPCR, we found that some of the lipid synthesis genes, such as β-ketoacyl-ACP reductase, fatty acid desaturase, acetyl-CoA carboxylase, acyl carrier protein, ∆8 desaturase, and Acyl-ACP thioesterase, were more actively expressed during light period, and two carbon fixation genes were up-regulated in the high-lipid illuminated cultures, suggesting a linkage between photosynthesis and lipid production. The lipid profile renders Eutreptiella sp. a nutritional prey and valuable source for nutraceuticals, and the biosynthesis pathway documented here will be useful for future research and applications.
-
5
المؤلفون: Cristina E. Tognon, Larisa Polonskaya, Tara Skelly, Shuang Cai, Francesmary Modugno, Larissa Rossell, Nancy Roche, Chen Huang, Jessika Baral, Fulvio D'Angelo, Wen-Wei Liang, Chia-Feng Tsai, Sneha P. Couvillion, Karin D. Rodland, Jun Zhu, Liang-Bo Wang, Paul D. Piehowski, Antonio Colaprico, Anupriya Agarwal, Matthew A. Wyczalkowski, Umut Ozbek, Francesca Petralia, Alexis Demopoulos, William W. Maggio, Lin Chen, Katherine A. Hoadley, Richard D. Smith, Sandra Cottingham, John McGee, Marcin J. Domagalski, Houxiang Zhu, Emek Demir, Rebecca I. Montgomery, Jamie Moon, Rashna Madan, George D. Wilson, Luciano Garofano, Ewa P. Malc, Chelsea J. Newton, Steven A. Carr, Chandan Kumar-Sinha, Donghui Tan, Christopher R. Kinsinger, Oxana Paklina, Weiqing Wan, Stephanie De Young, Sandra Cerda, Shankha Satpathy, Wojciech Kaspera, Linda Hannick, Gad Getz, Runyu Hong, Shuangjia Lu, Ziad Hanhan, Daniel C. Rohrer, Annette Marrero-Oliveras, Wojciech Szopa, Yuxing Liao, Amanda G. Paulovich, Jiayi Ji, Denis A. Golbin, Tara Hiltke, Weiva Sieh, Piotr A. Mieczkowski, Matthew E. Monroe, Gilbert S. Omenn, Jill S. Barnholtz-Sloan, Azra Krek, Bing Zhang, Brittany Henderson, Peter B. McGarvey, Ratna R. Thangudu, Maciej Wiznerowicz, Saravana M. Dhanasekaran, Alex Webster, Kai Li, Karna Robinson, Nan Ji, Karl K. Weitz, Simina M. Boca, Xiaoyu Song, Anna Calinawan, Adam C. Resnick, Brian J. Druker, Dana R. Valley, David J. Clark, Tao Liu, Eric J. Jaehnig, Alicia Francis, Michele Ceccarelli, Rui Zhao, Dmitry Rykunov, Boris Reva, Elizabeth R. Duffy, Antonio Iavarone, Dave Tabor, Joshua F. McMichael, Daniel Cui Zhou, Maureen Dyer, Kimberly Elburn, Scott D. Jewell, Negin Vatanian, Shirley Tsang, Seungyeul Yoo, Alexander R. Pico, Grace Zhao, Kent J. Bloodsworth, Chet Birger, Jena Lilly, Eunkyung An, Jeffrey R. Whiteaker, Albert H. Kim, Yige Wu, Karen A. Ketchum, Felipe D. Leprevost, Alcida Karz, Uma Borate, Nathan Edwards, Uma Velvulou, Melissa Borucki, Vasileios Stathias, Sanford P. Markey, Corbin D. Jones, Ronald J. Moore, MacIntosh Cornwell, Karsten Krug, Michael J. Birrer, James Suh, Tomasz Czernicki, Jason E. McDermott, Emily S. Boja, Pei Wang, Nina Martinez, Wenke Liu, Yan Shi, Lili Blumenberg, Emily Kawaler, Jeffrey W. Tyner, Feng Chen, Jakub Stawicki, Ki Sung Um, Arul M. Chinnaiyan, Robert Zelt, Jacob J. Day, Zhen Zhang, Caleb M. Lindgren, Li Ding, Nikolay Gabrovski, Hongwei Liu, Jonathan T. Lei, Alla Karpova, Ramani B. Kothadia, Sailaja Mareedu, Mitual Amin, Hannah Boekweg, Jennifer E. Kyle, Sara R. Savage, Brian R. Rood, Yuriy Zakhartsev, Matthew L. Anderson, Alyssa Charamut, Wagma Caravan, Shakti Ramkissoon, Junmei Wang, Song Cao, Samuel H. Payne, Rosalie K. Chu, Rajiv Dhir, David W. Andrews, Galen Hostetter, Liqun Qi, Zhiao Shi, Milan G. Chheda, Robert Edwards, Hui Zhang, Weiping Ma, Jennifer M. Eschbacher, Stacey Gabriel, Jan Lubinski, Lijun Yao, Erika M. Zink, Kelly L. Stratton, William Bocik, Mathangi Thiagarajan, Shilpi Singh, Michael A. Gillette, Lisa M. Bramer, Thomas L. Bauer, Michael Vernon, Henry Rodriguez, Dimitris G. Placantonakis, Eric E. Schadt, Alexey I. Nesvizhskii, Vladislav A. Petyuk, Ana I. Robles, Yvonne Shutack, Anna Malovannaya, Stephen E. Stein, Xi Chen, Lyndon Kim, Yize Li, Shannon Richey, Stephan C. Schürer, Barbara Hindenach, Matthew J. Ellis, Yongchao Dou, David Fenyö, Amy M. Perou, Olga Potapova, Shrabanti Chowdhury, Andrew K. Godwin, Marcin Cieślik, Michael C. Wendl, Marina A. Gritsenko, Pietro Pugliese, Elie Traer, Simona Migliozzi, D. R. Mani, Houston Culpepper, Gregory J. Riggins, Xiaolu Yang, Mehdi Mesri, David Chesla, Lindsey K. Olsen, Lori J. Sokoll, Suhas Vasaikar, Liwei Zhang, Meghan C. Burke, Kelly V. Ruggles, Qing Kay Li, Daniel W. Chan, Bo Wen, Nicollette Maunganidze, Darlene Tansil, Joseph H. Rothstein, Barbara Pruetz, Pushpa Hariharan
المساهمون: Wang, L. -B., Karpova, A., Gritsenko, M. A., Kyle, J. E., Cao, S., Li, Y., Rykunov, D., Colaprico, A., Rothstein, J. H., Hong, R., Stathias, V., Cornwell, M., Petralia, F., Wu, Y., Reva, B., Krug, K., Pugliese, P., Kawaler, E., Olsen, L. K., Liang, W. -W., Song, X., Dou, Y., Wendl, M. C., Caravan, W., Liu, W., Cui Zhou, D., Ji, J., Tsai, C. -F., Petyuk, V. A., Moon, J., Ma, W., Chu, R. K., Weitz, K. K., Moore, R. J., Monroe, M. E., Zhao, R., Yang, X., Yoo, S., Krek, A., Demopoulos, A., Zhu, H., Wyczalkowski, M. A., Mcmichael, J. F., Henderson, B. L., Lindgren, C. M., Boekweg, H., Lu, S., Baral, J., Yao, L., Stratton, K. G., Bramer, L. M., Zink, E., Couvillion, S. P., Bloodsworth, K. J., Satpathy, S., Sieh, W., Boca, S. M., Schurer, S., Chen, F., Wiznerowicz, M., Ketchum, K. A., Boja, E. S., Kinsinger, C. R., Robles, A. I., Hiltke, T., Thiagarajan, M., Nesvizhskii, A. I., Zhang, B., Mani, D. R., Ceccarelli, M., Chen, X. S., Cottingham, S. L., Li, Q. K., Kim, A. H., Fenyo, D., Ruggles, K. V., Rodriguez, H., Mesri, M., Payne, S. H., Resnick, A. C., Wang, P., Smith, R. D., Iavarone, A., Chheda, M. G., Barnholtz-Sloan, J. S., Rodland, K. D., Liu, T., Ding, L., Agarwal, A., Amin, M., An, E., Anderson, M. L., Andrews, D. W., Bauer, T., Birger, C., Birrer, M. J., Blumenberg, L., Bocik, W. E., Borate, U., Borucki, M., Burke, M. C., Cai, S., Calinawan, A. P., Carr, S. A., Cerda, S., Chan, D. W., Charamut, A., Chen, L. S., Chesla, D., Chinnaiyan, A. M., Chowdhury, S., Cieslik, M. P., Clark, D. J., Culpepper, H., Czernicki, T., D'Angelo, F., Day, J., De Young, S., Demir, E., Dhanasekaran, S. M., Dhir, R., Domagalski, M. J., Druker, B., Duffy, E., Dyer, M., Edwards, N. J., Edwards, R., Elburn, K., Ellis, M. J., Eschbacher, J., Francis, A., Gabriel, S., Gabrovski, N., Garofano, L., Getz, G., Gillette, M. A., Godwin, A. K., Golbin, D., Hanhan, Z., Hannick, L. I., Hariharan, P., Hindenach, B., Hoadley, K. A., Hostetter, G., Huang, C., Jaehnig, E., Jewell, S. D., Ji, N., Jones, C. D., Karz, A., Kaspera, W., Kim, L., Kothadia, R. B., Kumar-Sinha, C., Lei, J., Leprevost, F. D., Li, K., Liao, Y., Lilly, J., Liu, H., Lubinski, J., Madan, R., Maggio, W., Malc, E., Malovannaya, A., Mareedu, S., Markey, S. P., Marrero-Oliveras, A., Martinez, N., Maunganidze, N., Mcdermott, J. E., Mcgarvey, P. B., Mcgee, J., Mieczkowski, P., Migliozzi, S., Modugno, F., Montgomery, R., Newton, C. J., Omenn, G. S., Ozbek, U., Paklina, O. V., Paulovich, A. G., Perou, A. M., Pico, A. R., Piehowski, P. D., Placantonakis, D. G., Polonskaya, L., Potapova, O., Pruetz, B., Qi, L., Ramkissoon, S., Resnick, A., Richey, S., Riggins, G., Robinson, K., Roche, N., Rohrer, D. C., Rood, B. R., Rossell, L., Savage, S. R., Schadt, E. E., Shi, Y., Shi, Z., Shutack, Y., Singh, S., Skelly, T., Sokoll, L. J., Stawicki, J., Stein, S. E., Suh, J., Szopa, W., Tabor, D., Tan, D., Tansil, D., Thangudu, R. R., Tognon, C., Traer, E., Tsang, S., Tyner, J., Um, K. S., Valley, D. R., Vasaikar, S., Vatanian, N., Velvulou, U., Vernon, M., Wan, W., Wang, J., Webster, A., Wen, B., Whiteaker, J. R., Wilson, G. D., Zakhartsev, Y., Zelt, R., Zhang, H., Zhang, L., Zhang, Z., Zhao, G., Zhu, J.
المصدر: Cancer Cell
مصطلحات موضوعية: Proteomics, 0301 basic medicine, Cancer Research, CPTAC, Histone H2B acetylation, Protein Tyrosine Phosphatase, Non-Receptor Type 11, Computational biology, Biology, Article, 03 medical and health sciences, lipidome, 0302 clinical medicine, Metabolomics, proteogenomic, Humans, Phosphorylation, EP300, proteomic, Proteogenomics, acetylome, single nuclei RNA-seq, Brain Neoplasms, Phospholipase C gamma, glioblastoma, Computational Biology, Lipidome, 030104 developmental biology, Histone, Oncology, Acetylation, 030220 oncology & carcinogenesis, Mutation, biology.protein, metabolome, signaling
الوصف: Glioblastoma (GBM) is the most aggressive nervous system cancer. Understanding its molecular pathogenesis is crucial to improving diagnosis and treatment. Integrated analysis of genomic, proteomic, post-translational modification and metabolomic data on 99 treatment-naive GBMs provides insights to GBM biology. We identify key phosphorylation events (e.g., phosphorylated PTPN11 and PLCG1) as potential switches mediating oncogenic pathway activation, as well as potential targets for EGFR-, TP53-, and RB1-altered tumors. Immune subtypes with distinct immune cell types are discovered using bulk omics methodologies, validated by snRNA-seq, and correlated with specific expression and histone acetylation patterns. Histone H2B acetylation in classical-like and immune-low GBM is driven largely by BRDs, CREBBP, and EP300. Integrated metabolomic and proteomic data identify specific lipid distributions across subtypes and distinct global metabolic changes in IDH-mutated tumors. This work highlights biological relationships that could contribute to stratification of GBM patients for more effective treatment. Wang et al. perform integrated proteogenomic analysis of adult glioblastoma (GBM), including metabolomics, lipidomics, and single nuclei RNA-Seq, revealing insights into the immune landscape of GBM, cell-specific nature of EMT signatures, histone acetylation in classical GBM, and the existence of signaling hubs which could provide therapeutic vulnerabilities.
URL الوصول: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::7df38d0a8bf9434909b50050c641f50e
http://hdl.handle.net/11588/844575 -
6
المؤلفون: Yang Liu, Mauricio Oberti, Samuel H. Payne, Zhiao Shi, Minghui Ao, Mathangi Thiagarajan, D. R. Mani, Karen A. Ketchum, Jeffrey R. Whiteaker, Henry Rodriguez, Peter B. McGarvey, Xian Chen, Karl R. Clauser, Nathan Edwards, Amanda G. Paulovich, Shuang Cai, David L. Tabb, Heng Zhu, David F. Ransohoff, Mark A. Watson, Andrew N. Hoofnagle, Kelly V. Ruggles, Jiang Qian, Karin D. Rodland, Qing Kay Li, Daniel C. Liebler, Yingwei Hu, Hui Zhang, Christopher R. Kinsinger, Akhilesh Pandey, Tara Hiltke, Stephen E. Stein, Lijun Chen, Eric Kuhn, Richard D. Smith, Matthew J. Ellis, Subha Madhavan, Linda Hannick, Punit Shah, Kimberly Elburn, Yingming Zhao, Bing Zhang, Robert J.C. Slebos, Daniel W. Chan, Zhen Zhang, Jasmin H. Bavarva, Sherri R. Davies, David J. Clark, Li Ding, Mehdi Mesri, Jianbo Pan, Melinda E. Sanders, Douglas A. Levine, Forest M. White, Lisa J. Zimmerman, Steven A. Carr, Michael A. Gillette, Tao Liu, Yue Wang, Robert Rivers, Melissa Borucki, David Fenyö, Steven J. Skates, Ie Ming Shih, Gordon Whiteley, Michael Snyder, Raymond R. Townsend, Philip Mertins, Ratna R. Thangudu, Paul A. Rudnick, Michael Schnaubelt, Negin Vatanian, Jason E. McDermott, Stefani N. Thomas, Emily S. Boja
المصدر: Cell Reports, Vol 33, Iss 3, Pp 108276-(2020)
Cell Repمصطلحات موضوعية: Proteomics, 0301 basic medicine, animal structures, Glycosylation, CPTAC, glycosylation, macromolecular substances, Tissue Banks, Computational biology, Biology, Article, General Biochemistry, Genetics and Molecular Biology, 03 medical and health sciences, chemistry.chemical_compound, 0302 clinical medicine, Ovarian carcinoma, Biomarkers, Tumor, Humans, glycoproteomics, Gene, lcsh:QH301-705.5, Glycoproteins, mass spectrometry, Ovarian Neoplasms, chemistry.chemical_classification, Cystadenocarcinoma, Serous, Glycoproteomics, carbohydrates (lipids), Serous fluid, 030104 developmental biology, chemistry, lcsh:Biology (General), Phosphorylation, Female, lipids (amino acids, peptides, and proteins), tumor clusters, Technology Platforms, Glycoprotein, high-grade serous ovarian carcinoma, 030217 neurology & neurosurgery
الوصف: SUMMARY: Many gene products exhibit great structural heterogeneity because of an array of modifications. These modifications are not directly encoded in the genomic template but often affect the functionality of proteins. Protein glycosylation plays a vital role in proper protein functions. However, the analysis of glycoproteins has been challenging compared with other protein modifications, such as phosphorylation. Here, we perform an integrated proteomic and glycoproteomic analysis of 83 prospectively collected high-grade serous ovarian carcinoma (HGSC) and 23 non-tumor tissues. Integration of the expression data from global proteomics and glycoproteomics reveals tumor-specific glycosylation, uncovers different glycosylation associated with three tumor clusters, and identifies glycosylation enzymes that were correlated with the altered glycosylation. In addition to providing a valuable resource, these results provide insights into the potential roles of glycosylation in the pathogenesis of HGSC, with the possibility of distinguishing pathological outcomes of ovarian tumors from non-tumors, as well as classifying tumor clusters. IN BRIEF: Hu et al. provide an integrated proteomic and glycoproteomic characterization of high-grade serous ovarian carcinomas and relevant non-tumor tissues, which reveals tumor-specific glycosylation, uncovers different glycosylation associated with three tumor clusters, and identifies glycosylation enzymes correlated with glycosylation alterations.
وصف الملف: application/pdf
-
7
المؤلفون: Linda Hannick, Rita C. Kuo, James D. Stuart, Huan Zhang, Anthony A. Provatas, Senjie Lin
مصطلحات موضوعية: chemistry.chemical_classification, Fatty Acid Synthases, biology, Chemistry, Eicosapentaenoic acid, Acyl carrier protein, Fatty acid desaturase, Thioesterase, Biochemistry, Docosahexaenoic acid, biology.protein, lipids (amino acids, peptides, and proteins), Energy source, Polyunsaturated fatty acid
الوصف: Algal lipids are important fuel storage molecules in algae and a currency for energy transfer in the marine food chain as well as materials for biofuel production, but their production and regulation are not well understood in many species including the common coastal phytoplanktonEutreptiellaspp. Here, using gas chromatography-tandem mass spectrometry (GC/MS/MS), we discovered 24 types of fatty acids (FAs) inEutreptiellasp. with a relatively high proportion of long chain unsaturated FAs. The abundances of C16, C18 and saturated FAs decreased when phosphate in the culture medium was depleted. Among the 24 FAs, docosahexaenoic acid (22:6) and eicosapentaenoic acid (20:5) were the most abundant, suggesting thatEutreptiellasp. preferentially invests in the synthesis of very long chain polyunsaturated fatty acids (VLCPFA). Further transcriptomic analysis revealed thatEutreptiellasp. likely synthesizes VLCPFA via Δ8 pathway and uses type I and II fatty acid synthases. Using RT-qPCR, we found that some of the lipid production genes, such as β-ketoacyl-ACP reductase, fatty acid desaturase, acetyl-CoA carboxylase, acyl carrier protein, Δ8 desaturase, and Acyl-ACP thioesterase, were more actively expressed during light period. Besides, two carbon-fixation genes were more highly expressed in the high lipid illuminated cultures, suggesting a linkage between photosynthesis and lipid production.
URL الوصول: https://explore.openaire.eu/search/publication?articleId=doi_________::3cc848d0e1f4c44f7a28839dce5f23f8
https://doi.org/10.1101/2020.05.14.097162 -
8
المؤلفون: Tara Skelly, Wen Jiang, Zhen Zhang, Anupriya Agarwal, Amy M. Perou, Olga Potapova, Christopher R. Kinsinger, Matthew A. Wyczalkowski, David J. Clark, Shuang Cai, Felipe da Veiga Leprevost, Linda Hannick, Chen Huang, Paul D. Piehowski, John McGee, Marcin J. Domagalski, Dmitris Placantonakis, Jianbo Pan, Dana R. Valley, Zhiao Shi, Hui Yin Chang, Karen A. Ketchum, Charles A. Goldthwaite, Małgorzata Wierzbicka, Karsten Krug, Yvonne Shutack, Sara R. Savage, Matthew L. Anderson, Alyssa Charamut, Chandan Kumar-Sinha, Sanford P. Markey, Ratna R. Thangudu, Weiping Ma, Oliver F. Bathe, Antonio Colaprico, Yuxing Liao, Eric E. Schadt, Tomasz Czernicki, Seungyeul Yoo, Xi Chen, Stacey Gabriel, Karl R. Clauser, Daniel C. Rohrer, Uma Borate, Uma Velvulou, Larisa Polonskaya, M. Harry Kane, Dmitry M. Avtonomov, Boris Reva, Jacob J. Day, Barbara Hindenach, Matthew J. Ellis, Katherine A. Hoadley, Emek Demir, Rebecca I. Montgomery, Ewa P. Malc, Fengchao Yu, Lijun Yao, Maciej Wiznerowicz, Annette Marrero-Oliveras, Wojciech Szopa, Sailaja Mareedu, Galen Hostetter, Liqun Qi, Hui Zhang, Yige Wu, David N. Hayes, Shankha Satpathy, Corbin D. Jones, Michael J. Birrer, Xinpei Yi, Nathan Edwards, Fei Ding, Jiang Qian, Ning Qu, Alicia Francis, Daniel Cui Zhou, Jakub Stawicki, Bing Zhang, Rodrigo Vargas Eguez, Tao Liu, Dave Tabor, Maureen Dyer, Brian J. Druker, Gilbert S. Omenn, Azra Krek, Meenakshi Anurag, Melissa Borucki, Mathangi Thiagarajan, Shirley Tsang, Shakti Ramkissoon, Alexey I. Nesvizhskii, Li Ding, Lyubomir Valkov Vasilev, Yifat Geffen, James Suh, Tatiana S. Ermakova, Kakhaber Zaalishvili, Adel K. El-Naggar, Ki Sung Um, Ana I. Robles, Wen-Wei Liang, Richard D. Smith, Pei Wang, Emily S. Boja, Anna Calinawan, Yingwei Hu, Jiayi Ji, Renata Ferrarotto, Hongwei Liu, Jonathan T. Lei, Ramani B. Kothadia, Yize Li, Chelsea J. Newton, Anna Malovannaya, Steven A. Carr, Sandra Cerda, Yuriy Zakhartsev, Stephanie De Young, Eric J. Jaehnig, Peter B. McGarvey, Yan Shi, David I. Heiman, Joseph C. Dort, Karin D. Rodland, Lili Blumenberg, Michael A. Gillette, Piotr A. Mieczkowski, Pankaj Vats, Chet Birger, Yongchao Dou, David Fenyö, Saravana M. Dhanasekaran, Pushpa Hariharan, Eunkyung An, Jeffrey R. Whiteaker, George Miles, Jan Lubinski, Shayan C. Avanessian, Samuel H. Payne, Amanda G. Paulovich, Dmitry Rykunov, Lyudmila Petrenko, Martin Hyrcza, Guo Ci Teo, Alissa M. Weaver, D. R. Mani, Houston Culpepper, Meghan C. Burke, Daniel W. Chan, Bo Wen, Nicollette Maunganidze, Elie Traer, Darlene Tansil, Simona Migliozzi, Luciano Garofano, Qing Kay Li, Donghui Tan, Lori J. Sokoll, Mehdi Mesri, Karna Robinson, Fulvio D'Angelo, Kimberly Elburn, Alexander R. Pico, Umut Ozbek, Michael Schnaubelt, Gad Getz, Francesca Petralia, Andrew G. Sikora, Kai Li, Elena V. Ponomareva, Arul M. Chinnaiyan, Robert Zelt, Jun Zhu, Midie Xu, Dimitar Dimitrov Pazardzhikliev, Negin Vatanian, Grace Zhao, Thomas F. Westbrook, Kyung-Cho Cho, Yuefan Wang, Jason E. McDermott, Jeffrey W. Tyner, William Bocik, Shilpi Singh, Stephen E. Stein, Nancy Roche, Alicia Karz, Shannon Richey, Tara Hiltke, Michael Vernon, Lijun Chen, Henry Rodriguez, Xiaoyu Song, Elizabeth R. Duffy, Lin S. Chen, Liwei Cao, Shrabanti Chowdhury, Marcin Cieślik, Michael C. Wendl, Scott D. Jewell, Cristina E. Tognon
المصدر: Cancer Cell
مصطلحات موضوعية: Adult, Male, Proteomics, 0301 basic medicine, Cancer Research, medicine.medical_treatment, Cell, Biology, Article, Young Adult, 03 medical and health sciences, Antineoplastic Agents, Immunological, 0302 clinical medicine, Cyclin-dependent kinase, medicine, Humans, Aged, Proteogenomics, Aged, 80 and over, Squamous Cell Carcinoma of Head and Neck, Papillomavirus Infections, Phosphoproteomics, Immunotherapy, Middle Aged, medicine.disease, Head and neck squamous-cell carcinoma, Immune checkpoint, ErbB Receptors, 030104 developmental biology, medicine.anatomical_structure, Oncology, 030220 oncology & carcinogenesis, Cancer research, biology.protein, Female
الوصف: We present a proteogenomic study of 108 human papilloma virus (HPV)-negative head and neck squamous cell carcinomas (HNSCCs). Proteomic analysis systematically catalogs HNSCC-associated proteins and phosphosites, prioritizes copy number drivers, and highlights an oncogenic role for RNA processing genes. Proteomic investigation of mutual exclusivity between FAT1 truncating mutations and 11q13.3 amplifications reveals dysregulated actin dynamics as a common functional consequence. Phosphoproteomics characterizes two modes of EGFR activation, suggesting a new strategy to stratify HNSCCs based on EGFR ligand abundance for effective treatment with inhibitory EGFR monoclonal antibodies. Widespread deletion of immune modulatory genes accounts for low immune infiltration in immune-cold tumors, whereas concordant upregulation of multiple immune checkpoint proteins may underlie resistance to anti-programmed cell death protein 1 monotherapy in immune-hot tumors. Multi-omic analysis identifies three molecular subtypes with high potential for treatment with CDK inhibitors, anti-EGFR antibody therapy, and immunotherapy, respectively. Altogether, proteogenomics provides a systematic framework to inform HNSCC biology and treatment.
URL الوصول: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::be0519673cc5c55764abaf326e43ce8e
https://doi.org/10.1016/j.ccell.2020.12.007 -
9
المؤلفون: Yuxing Liao, Meghan C. Burke, Donghui Tan, Xiaoyu Song, Lauren C. Tang, Elizabeth R. Duffy, Shayan C. Avanessian, Daniel Cui Zhou, Maureen Dyer, Sara R. Savage, Jennifer M. Eschbacher, Shaleigh Smith, Alex Webster, Alicia Francis, Kelly V. Ruggles, Christopher R. Kinsinger, Shirley Tsang, Melissa Borucki, Nancy Roche, Pei Wang, Qing Kay Li, David Chesla, Ronald Matteotti, Zeynep H. Gümüş, Kai Li, Kei Suzuki, Thomas L. Bauer, Lori J. Sokoll, John McGee, Marcin J. Domagalski, Ki Sung Um, Tara Hiltke, Hai-Quan Chen, Hongwei Liu, Eric E. Schadt, Antonio Colaprico, Alyssa Charamut, Lijun Chen, Emily Kawaler, Ramani B. Kothadia, Mehdi Mesri, Jiayi Ji, Simina M. Boca, Myvizhi Esai Selvan, Emily S. Boja, Xi Chen, Shuang Cai, Kim Elburn, Samuel H. Payne, George D. Wilson, Peter B. McGarvey, Chelsea J. Newton, Felipe da Veiga Leprevost, Uma Velvulou, Tara Skelly, Corbin D. Jones, Michael J. Birrer, Steven A. Carr, Erik J. Bergstrom, Jeffrey R. Whiteaker, Michael H.A. Roehrl, Gad Getz, Tanya Krubit, Zhen Zhang, Yan Shi, Lili Blumenberg, Melanie A. MacMullan, Song Cao, Zhiao Shi, Weiping Ma, Chet Birger, Karl R. Clauser, Runyu Hong, Shankha Satpathy, Andrii Karnuta, Boris Reva, Barbara Hindenach, Matthew J. Ellis, Amanda G. Paulovich, Michael C. Wendl, Bing Zhang, Marina A. Gritsenko, Matthew A. Wyczalkowski, Stacey Gabriel, Michael A. Gillette, Jacob J. Day, Maciej Wiznerowicz, Stephen E. Stein, Ewa P. Malc, Robert J. Welsh, Sunita Shankar, Brian J. Druker, Li Ding, Lijun Yao, David J. Clark, Małgorzata Wojtyś, Dmitry Rykunov, Eugene S. Fedorov, Linda Hannick, Andrew K. Godwin, Sailaja Mareedu, Pushpa Hariharan, Mary Beth Beasley, Stephanie De Young, Arul M. Chinnaiyan, Robert Zelt, Mathangi Thiagarajan, Munziba Khan, Suhas Vasaikar, Tao Liu, Karin D. Rodland, Katherine A. Hoadley, Wen-Wei Liang, Ana I. Robles, Dana R. Valley, Sanford P. Markey, Mikhail Krotevich, David I. Heiman, Piotr A. Mieczkowski, Galen Hostetter, Liqun Qi, Yige Wu, Hui Zhang, Liang-Bo Wang, Nathan Edwards, Ramaswamy Govindan, Yifat Geffen, Seema Chugh, Alexey I. Nesvizhskii, Karen A. Ketchum, Pankaj Vats, Matthew E. Monroe, Marcin Cieslik, Yingwei Hu, Karsten Krug, Yosef E. Maruvka, Yize Li, Ratna R. Thangudu, William W. Maggio, Sandra Cottingham, Saravana M. Dhanasekaran, Wenke Liu, Hua Sun, Sonya Carter, Volodymyr Sovenko, M. Harry Kane, Annette Marrero-Oliveras, Barbara Pruetz, Amy M. Perou, Gilbert S. Omenn, Azra Krek, Olga Potapova, Michael S. Noble, Daniel W. Chan, Seungyeul Yoo, Eric J. Burks, Bo Wen, William Bocik, Michael Vernon, Henry Rodriguez, James Suh, Scott D. Jewell, MacIntosh Cornwell, Richard D. Smith, Chandan Kumar-Sinha, Halina M. Krzystek, Daniel C. Rohrer, Tatiana Omelchenko, D. R. Mani, Houston Culpepper, Vladislav A. Petyuk, Meng-Hong Sun, Michelle Chaikin, David Fenyö, Rahul Mannan, Bartosz Kubisa, Rohit Mehra, Rajwanth R. Veluswamy, Umut Ozbek, Michael Schnaubelt, Francesca Petralia, Elena V. Ponomareva, Rashna Madan, Pamela Grady, Karna Robinson, Negin Vatanian
المصدر: Cell
مصطلحات موضوعية: 0303 health sciences, Phosphoproteomics, Genomics, Environmental exposure, Computational biology, Biology, Proteomics, Proteogenomics, medicine.disease_cause, Article, General Biochemistry, Genetics and Molecular Biology, 03 medical and health sciences, 0302 clinical medicine, Neutrophil degranulation, medicine, KRAS, 030217 neurology & neurosurgery, 030304 developmental biology, Epigenomics
الوصف: To explore the biology of lung adenocarcinoma (LUAD) and identify new therapeutic opportunities, we performed comprehensive proteogenomic characterization of 110 tumors and 101 matched normal adjacent tissues (NATs) incorporating genomics, epigenomics, deep-scale proteomics, phosphoproteomics, and acetylproteomics. Multi-omics clustering revealed four subgroups defined by key driver mutations, country, and gender. Proteomic and phosphoproteomic data illuminated biology downstream of copy number aberrations, somatic mutations, and fusions and identified therapeutic vulnerabilities associated with driver events involving KRAS, EGFR, and ALK. Immune subtyping revealed a complex landscape, reinforced the association of STK11 with immune-cold behavior, and underscored a potential immunosuppressive role of neutrophil degranulation. Smoking-associated LUADs showed correlation with other environmental exposure signatures and a field effect in NATs. Matched NATs allowed identification of differentially expressed proteins with potential diagnostic and therapeutic utility. This proteogenomics dataset represents a unique public resource for researchers and clinicians seeking to better understand and treat lung adenocarcinomas.
URL الوصول: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::643fa1bca4947fad3182f7ffcf3016ad
https://doi.org/10.1016/j.cell.2020.06.013 -
10
المؤلفون: David J. Clark, Jiayi Ji, Beom-Jun Kim, Doug W. Chan, Zhen Zhang, Kim Elburn, Munziba Khan, Katherine Fuh, Katherine A. Hoadley, Jeffrey R. Whiteaker, Peter B. McGarvey, Dana R. Valley, Douglas A. Levine, Sanford P. Markey, Hui Zhang, Tanya Krubit, Christopher R. Kinsinger, Hui Yin Chang, Yuxing Liao, Karen A. Ketchum, Piotr A. Mieczkowski, Pankaj Vats, Matthew E. Monroe, Donghui Tan, Alex Webster, Chet Birger, Kai Li, Ramani Kothadia, Saravana M. Dhanasekaran, Sara R. Savage, Karsten Krug, Marcin Jędryka, Matthew L. Anderson, Alyssa Charamut, Alexander R. Pico, Amanda G. Paulovich, Karna Robinson, Hua Zhou, John McGee, Sean J.I. Beecroft, Amanda E. Oliphant, Annette Marrero-Oliveras, Dmitry Rykunov, Shuang Cai, Francesmary Modugno, Marcin J. Domagalski, Emily Kawaler, Mehdi Mesri, Dmitry M. Avtonomov, Milan G. Chheda, Sue Hilsenbeck, Gilbert S. Omenn, Emek Demir, Rebecca I. Montgomery, Qingsong Gao, Azra Krek, Eric E. Schadt, Li Ding, George D. Wilson, Stephen E. Stein, David Chesla, Gad Getz, Negin Vatanian, Thomas F. Westbrook, Deborah DeLair, David I. Heiman, Karl R. Clauser, Rafal Matkowski, Lori J. Sokoll, Uma Borate, Antonio Colaprico, Jin Chen, Eric J. Jaehnig, Karin D. Rodland, Richard D. Smith, Linda Hannick, Uma Velvulou, Shannon Richey, Andrzej Czekański, Bing Zhang, Arul M. Chinnaiyan, Robert Zelt, Daniel J. Geiszler, Emily L. Hoskins, Ronald J. Moore, Pushpa Hariharan, Suhas Vasaikar, Jason E. McDermott, Yige Wu, Anna Malovannaya, Brian J. Druker, Jeffrey W. Tyner, Yan Shi, Lili Blumenberg, Jamie Moon, Cristina E. Tognon, Chandan Kumar-Sinha, Nathan Edwards, Yifat Geffen, Barbara Hindenach, Matthew J. Ellis, Zhi Li, Michael Schnaubelt, David C. Wheeler, Tara Skelly, Ewa P. Malc, Shrabanti Chowdhury, Andrew K. Godwin, Zhiao Shi, Francesca Petralia, Lin Chen, Scott D. Jewell, Daniel C. Rohrer, Elie Traer, Michael Ittmann, Shankha Satpathy, Marcin Cieslik, Weiping Ma, Daniel Cui Zhou, Maureen Dyer, Boris Reva, Rashna Madan, William Bocik, Stacey Gabriel, Stephanie De Young, Yosef E. Maruvka, Sandra Cottingham, Pamela Grady, D. R. Mani, Houston Culpepper, Meenakshi Anurag, Michael T. Lewis, Anupriya Agarwal, Felipe D. Leprevost, Jonathan C. Jarman, Michael Vernon, Henry Rodriguez, Matthew A. Wyczalkowski, Rui Zhao, Vladislav A. Petyuk, Michelle Chaikin, James Suh, Daniel W. Chan, Bo Wen, Patricia Castro, Alexey I. Nesvizhskii, Chia-Feng Tsai, Grace Zhao, Alicia Francis, Feng Chen, Mathangi Thiagarajan, Pei Wang, Marina A. Gritsenko, Anna Calinawan, David G. Mutch, Melissa Borucki, Xi Steven Chen, Guo Ci Teo, Peter Dottino, Corbin D. Jones, Michael J. Birrer, Ying Wang, Meghan C. Burke, MacIntosh Cornwell, Song Cao, Rosalie K. Chu, Larisa Polonskaya, Samuel H. Payne, Darlene Tansil, Yongchao Dou, David Fenyö, Kelly V. Ruggles, Qing Kay Li, Yuping Zhang, James J. Hsieh, Andy T. Kong, Ana I. Robles, Emily S. Boja, Chelsea J. Newton, Steven A. Carr, Sandra Cerda, Runyu Hong, Jacob J. Day, Sailaja Mareedu, Jan Lubinski, Galen Hostetter, Liqun Qi, Yize Li, Chen Huang, Liang-Bo Wang, Tao Liu, Renee Karabon, Paul D. Piehowski, Samuel L. Pugh, Maciej Wiznerowicz, Ratna R. Thangudu, Wenke Liu, Jayson B. Field, Sonya Carter, Ki Sung Um, Hongwei Liu, Alla Karpova, Yuriy Zakhartsev, Amy M. Perou, Michael S. Noble, Rajiv Dhir, Nancy Roche, Sunantha Sethuraman, Tara Hiltke, Lijun Chen, Xiaoyu Song, Elizabeth R. Duffy, Robert Edwards, Yingwei Hu, John A. Martignetti, Simina M. Boca, Michael A. Gillette, David W Adams
المصدر: Cell
مصطلحات موضوعية: Epithelial-Mesenchymal Transition, Proteome, Druggability, Biology, Proteomics, Genomic Instability, Article, General Biochemistry, Genetics and Molecular Biology, Mice, 03 medical and health sciences, 0302 clinical medicine, Antigens, Neoplasm, medicine, Animals, Humans, Phosphorylation, 030304 developmental biology, Feedback, Physiological, 0303 health sciences, Endometrial cancer, Carcinoma, Wnt signaling pathway, Cancer, Acetylation, medicine.disease, Proteogenomics, Endometrial Neoplasms, Gene Expression Regulation, Neoplastic, MicroRNAs, Serous fluid, Histone, Cancer research, biology.protein, Female, Transcriptome, Protein Processing, Post-Translational, 030217 neurology & neurosurgery, Microsatellite Repeats, Signal Transduction
الوصف: We undertook a comprehensive proteogenomic characterization of 95 prospectively collected endometrial carcinomas, comprising 83 endometrioid and 12 serous tumors. This analysis revealed possible new consequences of perturbations to the p53 and Wnt/β-catenin pathways, identified a potential role for circRNAs in the epithelial-mesenchymal transition, and provided new information about proteomic markers of clinical and genomic tumor subgroups, including relationships to known druggable pathways. An extensive genome-wide acetylation survey yielded insights into regulatory mechanisms linking Wnt signaling and histone acetylation. We also characterized aspects of the tumor immune landscape, including immunogenic alterations, neoantigens, common cancer/testis antigens, and the immune microenvironment, all of which can inform immunotherapy decisions. Collectively, our multi-omic analyses provide a valuable resource for researchers and clinicians, identify new molecular associations of potential mechanistic significance in the development of endometrial cancers, and suggest novel approaches for identifying potential therapeutic targets.
URL الوصول: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::aa0d0cef393bf866d504e33d254c8136
https://doi.org/10.1016/j.cell.2020.01.026
Full Text Finder