دورية أكاديمية
In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor.
| العنوان: | In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor. |
|---|---|
| المؤلفون: | Asmare MM; Department of Agricultural Convergence Technology, College of Agriculture and Life Science, Jeonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do, 54896, Republic of Korea., Krishnaraj C; Department of Agricultural Convergence Technology, College of Agriculture and Life Science, Jeonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do, 54896, Republic of Korea; Department of Food Science and Technology, College of Agriculture and Life Sciences, Jeonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do, 54896, Republic of Korea., Radhakrishnan S; Department of Organic Materials & Fiber Engineering, Jeonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do, 54896, Republic of Korea., Kim BS; Department of Organic Materials & Fiber Engineering, Jeonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do, 54896, Republic of Korea., Yoon JS; Department of Agricultural Convergence Technology, College of Agriculture and Life Science, Jeonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do, 54896, Republic of Korea. Electronic address: jsyoon@jbnu.ac.kr., Yun SI; Department of Agricultural Convergence Technology, College of Agriculture and Life Science, Jeonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do, 54896, Republic of Korea; Department of Food Science and Technology, College of Agriculture and Life Sciences, Jeonbuk National University, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do, 54896, Republic of Korea. Electronic address: siyun@jbnu.ac.kr. |
| المصدر: | Journal of molecular graphics & modelling [J Mol Graph Model] 2024 Jul; Vol. 130, pp. 108787. Date of Electronic Publication: 2024 May 05. |
| نوع المنشور: | Journal Article |
| اللغة: | English |
| بيانات الدورية: | Publisher: Elsevier Science, Inc Country of Publication: United States NLM ID: 9716237 Publication Model: Print-Electronic Cited Medium: Internet ISSN: 1873-4243 (Electronic) Linking ISSN: 10933263 NLM ISO Abbreviation: J Mol Graph Model Subsets: MEDLINE |
| أسماء مطبوعة: | Original Publication: New York, NY : Elsevier Science, Inc., c1997- |
| مواضيع طبية MeSH: | Ciprofloxacin*/chemistry , Ciprofloxacin*/analysis , Aptamers, Nucleotide*/chemistry , Biosensing Techniques*/methods , Molecular Dynamics Simulation* , Molecular Docking Simulation*, Computer Simulation |
| مستخلص: | Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10 -9 - 200 × 10 -9 M), detection limit (1.0 × 10 -9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples. Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. (Copyright © 2024 Elsevier Inc. All rights reserved.) |
| فهرسة مساهمة: | Keywords: Ciprofloxacin; DNA aptamer; Electrochemistry; MD simulation; QPLD |
| المشرفين على المادة: | 5E8K9I0O4U (Ciprofloxacin) 0 (Aptamers, Nucleotide) |
| تواريخ الأحداث: | Date Created: 20240515 Date Completed: 20240529 Latest Revision: 20240529 |
| رمز التحديث: | 20240530 |
| DOI: | 10.1016/j.jmgm.2024.108787 |
| PMID: | 38749234 |
| قاعدة البيانات: | MEDLINE |
Full Text Finder | تدمد: | 1873-4243 |
|---|---|
| DOI: | 10.1016/j.jmgm.2024.108787 |